Cigar Class Reference

This class represents the CIGAR without any methods to set the cigar (see CigarRoller for that). More...

#include <Cigar.h>

Inheritance diagram for Cigar:

[legend]

Collaboration diagram for Cigar:

[legend]

List of all members.

Classes
struct	CigarOperator
Public Types
enum	Operation {   none = 0, match, mismatch, insert,   del, skip, softClip, hardClip,   pad }
	Enum for the cigar operations. More...
Public Member Functions
	Cigar ()
	Default constructor initializes as a CIGAR with no operations.
void	getCigarString (String &cigarString) const
	Set the passed in String to the string reprentation of the Cigar operations in this object.
void	getCigarString (std::string &cigarString) const
	Set the passed in std::string to the string reprentation of the Cigar operations in this object.
void	getExpandedString (std::string &s) const
	Sets the specified string to a valid CIGAR string of characters that represent the cigar with no digits (a CIGAR of "3M" would return "MMM").
const CigarOperator &	operator[] (int i) const
	Return the Cigar Operation at the specified index (starting at 0).
const CigarOperator &	getOperator (int i) const
	Return the Cigar Operation at the specified index (starting at 0).
bool	operator== (Cigar &rhs) const
	Return true if the 2 Cigars are the same (the same operations of the same sizes).
int	size () const
	Return the number of cigar operations.
void	Dump () const
	Write this object as a string to cout.
int	getExpectedQueryBaseCount () const
	Return the length of the read that corresponds to the current CIGAR string.
int	getExpectedReferenceBaseCount () const
	Return the number of bases in the reference that this CIGAR "spans".
int	getNumBeginClips () const
	Return the number of clips that are at the beginning of the cigar.
int	getNumEndClips () const
	Return the number of clips that are at the end of the cigar.
int32_t	getRefOffset (int32_t queryIndex)
	Return the reference offset associated with the specified query index or INDEX_NA based on this cigar.
int32_t	getQueryIndex (int32_t refOffset)
	Return the query index associated with the specified reference offset or INDEX_NA based on this cigar.
int32_t	getRefPosition (int32_t queryIndex, int32_t queryStartPos)
	Return the reference position associated with the specified query index or INDEX_NA based on this cigar and the specified queryStartPos which is the leftmost mapping position of the first matching base in the query.
int32_t	getQueryIndex (int32_t refPosition, int32_t queryStartPos)
	Return the query index or INDEX_NA associated with the specified reference offset when the query starts at the specified reference position.
uint32_t	getNumOverlaps (int32_t start, int32_t end, int32_t queryStartPos)
	Return the number of bases that overlap the reference and the read associated with this cigar that falls within the specified region.
bool	hasIndel ()
	Return whether or not the cigar has indels (insertions or delections).
Static Public Member Functions
static bool	foundInQuery (Operation op)
	Return true if the specified operation is found in the query sequence, false if not.
static bool	foundInQuery (CigarOperator op)
	Return true if the specified operation is found in the query sequence, false if not.
static bool	isClip (Operation op)
	Return true if the specified operation is a clipping operation, false if not.
static bool	isClip (CigarOperator op)
	Return true if the specified operation is a clipping operation, false if not.
static bool	isMatchOrMismatch (Operation op)
	Return true if the specified operation is a match/mismatch operation, false if not.
static bool	isMatchOrMismatch (CigarOperator op)
	Return true if the specified operation is a match/mismatch operation, false if not.
Static Public Attributes
static const int	MAX_OP_VALUE = pad
static const int32_t	INDEX_NA = -1
	Value associated with an index that is not applicable/does not exist, used for converting between query and reference indexes/offsets when an associated index/offset does not exist.
Protected Member Functions
void	clearQueryAndReferenceIndexes ()
void	setQueryAndReferenceIndexes ()
Protected Attributes
std::vector< CigarOperator >	cigarOperations
Friends
std::ostream &	operator<< (std::ostream &stream, const Cigar &cigar)
	Writes all of the cigar operations contained in the cigar to the passed in stream.

---

Detailed Description

This class represents the CIGAR without any methods to set the cigar (see CigarRoller for that).

Docs from Sam1.pdf: Clipped alignment. In Smith-Waterman alignment, a sequence may not be aligned from the first residue to the last one. Subsequences at the ends may be clipped off. We introduce operation ʻSʼ to describe (softly) clipped alignment. Here is an example. Suppose the clipped alignment is: REF: AGCTAGCATCGTGTCGCCCGTCTAGCATACGCATGATCGACTGTCAGCTAGTCAGACTAGTCGATCGATGTG READ: gggGTGTAACC-GACTAGgggg where on the read sequence, bases in uppercase are matches and bases in lowercase are clipped off. The CIGAR for this alignment is: 3S8M1D6M4S.

If the mapping position of the query is not available, RNAME and CIGAR are set as “*”

A CIGAR string is comprised of a series of operation lengths plus the operations. The conventional CIGAR format allows for three types of operations: M for match or mismatch, I for insertion and D for deletion. The extended CIGAR format further allows four more operations, as is shown in the following table, to describe clipping, padding and splicing:

op Description -- ----------- M Match or mismatch I Insertion to the reference D Deletion from the reference N Skipped region from the reference S Soft clip on the read (clipped sequence present in <seq>) H Hard clip on the read (clipped sequence NOT present in <seq>) P Padding (silent deletion from the padded reference sequence) This class represents the CIGAR. It contains methods for converting to strings and extracting information from the cigar on how a read maps to the reference.

It only contains read only methods. There are no ways to set values. To set a value, a child class must be used.

Definition at line 83 of file Cigar.h.

---

Member Enumeration Documentation

enum Cigar::Operation

Enum for the cigar operations.

Enumerator:

none	no operation has been set.
match	match/mismatch operation. Associated with CIGAR Operation "M"
mismatch	mismatch operation. Associated with CIGAR Operation "M"
insert	insertion to the reference (the query sequence contains bases that have no corresponding base in the reference). Associated with CIGAR Operation "I"
del	deletion from the reference (the reference contains bases that have no corresponding base in the query sequence). Associated with CIGAR Operation "D"
skip	skipped region from the reference (the reference contains bases that have no corresponding base in the query sequence). Associated with CIGAR Operation "N"
softClip	Soft clip on the read (clipped sequence present in the query sequence, but not in reference). Associated with CIGAR Operation "S".
hardClip	Hard clip on the read (clipped sequence not present in the query sequence or reference). Associated with CIGAR Operation "H".
pad	Padding (not in reference or query). Associated with CIGAR Operation "P".

Definition at line 87 of file Cigar.h.

                   {
        none=0, ///< no operation has been set.
        match, ///< match/mismatch operation.  Associated with CIGAR Operation "M"
        mismatch, ///< mismatch operation.  Associated with CIGAR Operation "M"
        insert,  ///< insertion to the reference (the query sequence contains bases that have no corresponding base in the reference).  Associated with CIGAR Operation "I"
        del,  ///< deletion from the reference (the reference contains bases that have no corresponding base in the query sequence).  Associated with CIGAR Operation "D"
        skip,  ///< skipped region from the reference (the reference contains bases that have no corresponding base in the query sequence).  Associated with CIGAR Operation "N"
        softClip,  ///< Soft clip on the read (clipped sequence present in the query sequence, but not in reference).  Associated with CIGAR Operation "S"
        hardClip,  ///< Hard clip on the read (clipped sequence not present in the query sequence or reference).  Associated with CIGAR Operation "H"
        pad ///< Padding (not in reference or query).  Associated with CIGAR Operation "P"
    };

---

Member Function Documentation

static bool Cigar::foundInQuery

(

CigarOperator

op

)

[inline, static]

Return true if the specified operation is found in the query sequence, false if not.

Definition at line 194 of file Cigar.h.

References insert, match, mismatch, and softClip.

    {
        switch(op.operation)
        {
            case match:
            case mismatch:
            case insert:
            case softClip:
                return true;
            default:
                return false;
        }
        return false;
    }

static bool Cigar::foundInQuery

(

Operation

op

)

[inline, static]

Return true if the specified operation is found in the query sequence, false if not.

Definition at line 177 of file Cigar.h.

References insert, match, mismatch, and softClip.

Referenced by SamRecord::shiftIndelsLeft(), and SamFilter::softClip().

    {
        switch(op)
        {
            case match:
            case mismatch:
            case insert:
            case softClip:
                return true;
            default:
                return false;
        }
        return false;
    }

void Cigar::getCigarString

(

std::string &

cigarString

)

const

Set the passed in std::string to the string reprentation of the Cigar operations in this object.

Definition at line 36 of file Cigar.cpp.

{
    using namespace STLUtilities;

    std::vector<CigarOperator>::const_iterator i;

    cigarString.clear();  // clear result string

    // Progressively append the character representations of the operations to
    // the cigar string.
    for (i = cigarOperations.begin(); i != cigarOperations.end(); i++)
    {
        cigarString << (*i).count << (*i).getChar();
    }
}

void Cigar::getCigarString

(

String &

cigarString

)

const

Set the passed in String to the string reprentation of the Cigar operations in this object.

Definition at line 52 of file Cigar.cpp.

Referenced by Dump(), and SamRecord::setCigar().

{
    std::string cigar;

    getCigarString(cigar);

    cigarString = cigar.c_str();

    return;
}

void Cigar::getExpandedString

(

std::string &

s

)

const

Sets the specified string to a valid CIGAR string of characters that represent the cigar with no digits (a CIGAR of "3M" would return "MMM").

The returned string is actually also a valid CIGAR string. In theory this makes it easier to parse some reads.

Returns:

s the string to populate

Definition at line 63 of file Cigar.cpp.

{
    s = "";

    std::vector<CigarOperator>::const_iterator i;

    // Progressively append the character representations of the operations to
    // the string passed in

    for (i = cigarOperations.begin(); i != cigarOperations.end(); i++)
    {
        for (uint32_t j = 0; j<(*i).count; j++) s += (*i).getChar();
    }
    return;
}

int Cigar::getExpectedQueryBaseCount

(

)

const

Return the length of the read that corresponds to the current CIGAR string.

For validation, we should expect that a sequence read in a SAM file will be the same length as the value returned by this method.

Example: 3M2D3M describes a read with three bases matching the reference, then skips 2 bases, then has three more bases that match the reference (match/mismatch). In this case, the read length is expected to be 6.

Example: 3M2I3M describes a read with 3 match/mismatch bases, two extra bases, and then 3 more match/mistmatch bases. The total in this example is 8 bases.

Returns:

returns the expected read length

Definition at line 95 of file Cigar.cpp.

References insert, match, mismatch, and softClip.

Referenced by SamFilter::softClip().

{
    int matchCount = 0;
    std::vector<CigarOperator>::const_iterator i;
    for (i = cigarOperations.begin(); i != cigarOperations.end(); i++)
    {
        switch (i->operation)
        {
            case match:
            case mismatch:
            case softClip:
            case insert:
                matchCount += i->count;
                break;
            default:
                // we only care about operations that are in the query sequence.
                break;
        }
    }
    return matchCount;
}

int Cigar::getExpectedReferenceBaseCount

(

)

const

Return the number of bases in the reference that this CIGAR "spans".

When doing range checking, we occassionally need to know how many total bases the CIGAR string represents as compared to the reference.

Examples: 3M2D3M describes a read that overlays 8 bases in the reference. 3M2I3M describes a read with 3 bases that match the reference, two additional bases that aren't in the reference, and 3 more bases that match the reference, so it spans 6 bases in the reference.

Returns:

how many bases in the reference are spanned by the given CIGAR string

Definition at line 120 of file Cigar.cpp.

References del, match, mismatch, and skip.

Referenced by SamTags::createMDTag().

{
    int matchCount = 0;
    std::vector<CigarOperator>::const_iterator i;
    for (i = cigarOperations.begin(); i != cigarOperations.end(); i++)
    {
        switch (i->operation)
        {
            case match:
            case mismatch:
            case del:
            case skip:
                matchCount += i->count;
                break;
            default:
                // we only care about operations that are in the reference sequence.
                break;
        }
    }
    return matchCount;
}

uint32_t Cigar::getNumOverlaps	(	int32_t	start,
		int32_t	end,
		int32_t	queryStartPos
	)

Return the number of bases that overlap the reference and the read associated with this cigar that falls within the specified region.

Parameters:

	start	: inclusive 0-based start position (reference position) of the region to check for overlaps in (-1 indicates to start at the beginning of the reference.)
	end	: exclusive 0-based end position (reference position) of the region to check for overlaps in (-1 indicates to go to the end of the reference.)
	queryStartPos	: 0-based leftmost mapping position of the first matcihng base in the query.

Definition at line 260 of file Cigar.cpp.

References getRefOffset().

Referenced by SamRecord::getNumOverlaps().

{
    // Get the overlap info.
    if ((queryToRef.size() == 0) || (refToQuery.size() == 0))
    {
        setQueryAndReferenceIndexes();
    }

    // Get the start and end offsets.
    int32_t startRefOffset = 0;
    // If the specified start is more than the queryStartPos, set
    // the startRefOffset to the appropriate non-zero value.
    // (if start is <= queryStartPos, than startRefOffset is 0 - it should
    // not be set to a negative value.)
    if (start > queryStartPos)
    {
        startRefOffset = start - queryStartPos;
    }

    int32_t endRefOffset = end - queryStartPos;
    if (end  == -1)
    {
        // -1 means that the region goes to the end of the refrerence.
        // So set endRefOffset to the max refOffset + 1 which is the
        // size of the refToQuery vector.
        endRefOffset = refToQuery.size();
    }


    // if endRefOffset is less than 0, then this read does not fall within
    // the specified region, so return 0.
    if (endRefOffset < 0)
    {
        return(0);
    }

    // Get the overlaps for these offsets.
    // Loop through the read counting positions that match the reference
    // within this region.
    int32_t refOffset = 0;
    int32_t numOverlaps = 0;
    for (unsigned int queryIndex = 0; queryIndex < queryToRef.size();
            queryIndex++)
    {
        refOffset = getRefOffset(queryIndex);
        if (refOffset > endRefOffset)
        {
            // Past the end of the specified region, so stop checking
            // for overlaps since there will be no more.
            break;
        }
        else if ((refOffset >= startRefOffset) && (refOffset < endRefOffset))
        {
            // within the region, increment the counter.
            ++numOverlaps;
        }
    }

    return(numOverlaps);
}

int32_t Cigar::getQueryIndex	(	int32_t	refPosition,
		int32_t	queryStartPos
	)

Return the query index or INDEX_NA associated with the specified reference offset when the query starts at the specified reference position.

Definition at line 240 of file Cigar.cpp.

References INDEX_NA.

{
    // If the vectors aren't set, set them.
    if ((queryToRef.size() == 0) || (refToQuery.size() == 0))
    {
        setQueryAndReferenceIndexes();
    }

    int32_t refOffset = refPosition - queryStartPos;
    if ((refOffset < 0) || ((uint32_t)refOffset >= refToQuery.size()))
    {
        return(INDEX_NA);
    }

    return(refToQuery[refOffset]);
}

int32_t Cigar::getQueryIndex

(

int32_t

refOffset

)

Return the query index associated with the specified reference offset or INDEX_NA based on this cigar.

Definition at line 202 of file Cigar.cpp.

References INDEX_NA.

Referenced by SamTags::createMDTag().

{
    // If the vectors aren't set, set them.
    if ((queryToRef.size() == 0) || (refToQuery.size() == 0))
    {
        setQueryAndReferenceIndexes();
    }
    if ((refOffset < 0) || ((uint32_t)refOffset >= refToQuery.size()))
    {
        return(INDEX_NA);
    }
    return(refToQuery[refOffset]);
}

int32_t Cigar::getRefOffset

(

int32_t

queryIndex

)

Return the reference offset associated with the specified query index or INDEX_NA based on this cigar.

Definition at line 187 of file Cigar.cpp.

References INDEX_NA.

Referenced by SamQuerySeqWithRefIter::getNextMatchMismatch(), getNumOverlaps(), SamQuerySeqWithRef::seqWithEquals(), and SamQuerySeqWithRef::seqWithoutEquals().

{
    // If the vectors aren't set, set them.
    if ((queryToRef.size() == 0) || (refToQuery.size() == 0))
    {
        setQueryAndReferenceIndexes();
    }
    if ((queryIndex < 0) || ((uint32_t)queryIndex >= queryToRef.size()))
    {
        return(INDEX_NA);
    }
    return(queryToRef[queryIndex]);
}

int32_t Cigar::getRefPosition	(	int32_t	queryIndex,
		int32_t	queryStartPos
	)

Return the reference position associated with the specified query index or INDEX_NA based on this cigar and the specified queryStartPos which is the leftmost mapping position of the first matching base in the query.

Definition at line 217 of file Cigar.cpp.

References INDEX_NA.

Referenced by SamFilter::softClip().

{
    // If the vectors aren't set, set them.
    if ((queryToRef.size() == 0) || (refToQuery.size() == 0))
    {
        setQueryAndReferenceIndexes();
    }
    if ((queryIndex < 0) || ((uint32_t)queryIndex >= queryToRef.size()))
    {
        return(INDEX_NA);
    }

    if (queryToRef[queryIndex] != INDEX_NA)
    {
        return(queryToRef[queryIndex] + queryStartPos);
    }
    return(INDEX_NA);
}

bool Cigar::hasIndel

(

)

Return whether or not the cigar has indels (insertions or delections).

Returns:

true if it has an insertion or deletion, false if not.

Definition at line 324 of file Cigar.cpp.

References del, and insert.

{
    for(unsigned int i = 0; i < cigarOperations.size(); i++)
    {
        if((cigarOperations[i].operation == insert) ||
           (cigarOperations[i].operation == del))
        {
            // Found an indel, so return true.
            return(true);
        }
    }
    // Went through all the operations, and found no indel, so return false.
    return(false);
}

static bool Cigar::isClip

(

CigarOperator

op

)

[inline, static]

Return true if the specified operation is a clipping operation, false if not.

Definition at line 226 of file Cigar.h.

References hardClip, and softClip.

    {
        switch(op.operation)
        {
            case softClip:
            case hardClip:
                return true;
            default:
                return false;
        }
        return false;
    }

static bool Cigar::isClip

(

Operation

op

)

[inline, static]

Return true if the specified operation is a clipping operation, false if not.

Definition at line 211 of file Cigar.h.

References hardClip, and softClip.

Referenced by SamFilter::softClip().

    {
        switch(op)
        {
            case softClip:
            case hardClip:
                return true;
            default:
                return false;
        }
        return false;
    }

static bool Cigar::isMatchOrMismatch

(

CigarOperator

op

)

[inline, static]

Return true if the specified operation is a match/mismatch operation, false if not.

Definition at line 256 of file Cigar.h.

References match, and mismatch.

    {
        switch(op.operation)
        {
            case match:
            case mismatch:
                return true;
            default:
                return false;
        }
        return false;
    }

static bool Cigar::isMatchOrMismatch

(

Operation

op

)

[inline, static]

Return true if the specified operation is a match/mismatch operation, false if not.

Definition at line 241 of file Cigar.h.

References match, and mismatch.

Referenced by SamRecord::shiftIndelsLeft().

    {
        switch(op)
        {
            case match:
            case mismatch:
                return true;
            default:
                return false;
        }
        return false;
    }

bool Cigar::operator==

(

Cigar &

rhs

)

const

Return true if the 2 Cigars are the same (the same operations of the same sizes).

Definition at line 80 of file Cigar.cpp.

References size().

{

    if (this->size() != rhs.size()) return false;

    for (int i = 0; i < this->size(); i++)
    {
        if (cigarOperations[i]!=rhs.cigarOperations[i]) return false;
    }
    return true;
}

---

Member Data Documentation

const int32_t Cigar::INDEX_NA = -1 [static]

Value associated with an index that is not applicable/does not exist, used for converting between query and reference indexes/offsets when an associated index/offset does not exist.

Definition at line 409 of file Cigar.h.

Referenced by SamTags::createMDTag(), SamQuerySeqWithRefIter::getNextMatchMismatch(), getQueryIndex(), getRefOffset(), getRefPosition(), SamQuerySeqWithRef::seqWithEquals(), and SamQuerySeqWithRef::seqWithoutEquals().

---

The documentation for this class was generated from the following files:

• general/Cigar.h
• general/Cigar.cpp